BSU13930

BSU_13930

1026

1029

BSU13930

BSU_13930

1,461,770 -> 1,462,798

1,461,770 → 1,462,798

repairs a special thymine dimer (5-thyminyl-5,6-dihydrothymine), which is commonly called spore photoproduct at the early germination phase

repairs a special thymine dimer (5-thyminyl-5,6-dihydrothymine), which is commonly called spore photoproduct at the early germination phase

(5R)-5,6-dihydro-5-(thymidin-7-yl)thymidine in DNA --> thymidine dimer in DNA (according to UniProt)

contains a [4Fe-4S] cluster, uses the [4Fe-4S] cluster to reduce SAM

Fe-S cluster [pubmed|29292548]

uses the [4Fe-4S] cluster to reduce SAM

BP130 (del ''splB''::''spc''), available in [SW|Fabian Commichau]'s lab

BP130 (Δ''splB''::''spc''), available in [SW|Fabian Commichau]'s and [SW|Jörg Stülke]'s labs [pubmed|30054368]

BKE13930 (Δ[[gene|splB]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGCCACATCCTTTTC, downstream forward: _UP4_TTCACTTAAACGGGCTGTTG

BKK13930 (Δ[[gene|splB]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGCCACATCCTTTTC, downstream forward: _UP4_TTCACTTAAACGGGCTGTTG

15699190, 8021181, 21671623, 22197590, 23607538, 23799365, 22761404, 16829676, 11470912, 22906093, 16829680, 11902862, 9733691

15699190, 8021181, 21671623, 22197590, 23607538, 23799365, 22761404, 16829676, 11470912, 22906093, 16829680, 11902862, 9733691, 28401144, 30054368

sensitive to blue light-induced DNA damage [pubmed|30054368]

[SW|Radical SAM superfamily] (according to UniProt)

[[this]]